mouse c2c12 myoblast culture mouse c2c12 myoblasts Search Results


99
ATCC cell culture mouse mycoplasma free c2c12 cells
VLDL induces ER stress and inflammation. Mouse <t>C2C12</t> myotubes were incubated in the presence (black bars) or absence (control, Ct, white bars) of 300 μg/ml VLDL for 24 h. (a) mRNA abundance of Bip, Chop and Nqo1. mRNA levels are normalised to Aprt (n = 8–10, five independent C2C12 cultures were used). (b) BiP, phospho-eIF2α (Ser51), TRB3, CHOP and β-actin protein levels. (c), mRNA abundance of Il6, Mcp1, Tnfα, IκBα and Socs3. (d) IκBα, p65 and β-actin protein levels. (e) Phospho-STAT3 (Tyr705), SOCS3 and β-actin protein levels. The graphs show quantification expressed as a percentage of control samples. Data are means ± SD of five independent experiments and were compared by Student’s t test. *p < 0.05, **p < 0.01 and ***p < 0.001 vs control
Cell Culture Mouse Mycoplasma Free C2c12 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+c2c12+myoblast+culture+mouse+c2c12+myoblasts/C2C12/pmc06078195-60-0-7
Average 99 stars, based on 1 article reviews
cell culture mouse mycoplasma free c2c12 cells - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
MedChemExpress c2c12 myotubes
( A ) Western blot analysis of SH3KBP1 protein levels in total protein extracts obtained from growing (GM) or differentiating <t>C2C12</t> cells (from 1 to 5 days). C2C12 differentiation is assessed by Myogenin expression and Tubulin is used as loading control. ( B ) RT-qPCR analysis of Sh3kbp1 gene expression level relative to housekeeping genes ( CycloB, Gapdh, GusB, Rpl41 , and Tbp ) in proliferating C2C12 cells (GM) or in differentiating C2C12 (1 to 5 days of differentiation). ( C ) Representative western blots analysis of SH3KBP1 protein downregulation in stable cell line constitutively expressing shRNA construct targeting Sh3kbp1 . Tubulin is used as loading control. ( D , E ) Representative immunofluorescence staining of myosin heavy chain (green) and myonuclei (red) in C2C12 stable cell lines expressing scramble shRNA ( D ) or shRNA targeting Sh3kbp1 ( E ) after 3 or 6 days of differentiation. Zooms are magnifications of images in white dots rectangles in 6 days old myotubes. Scale bars: 150 µm, 15 µm in zoom. ( F , G ) Representatives immunofluorescent staining of myosin heavy chain (green) and myonuclei (red) in stable cell line expressing Sh3kbp1 shRNA, co-transfected with plasmid coding either for mCherry ( F ) or the full-length human SH3KBP1 ( G ) after 5 days of differentiation. Scale bar: 150 µm. ( H ) Quantification of the percentage of myonuclei per clusters observed in ( D – G ) experiments. Statistical analysis performed using unpaired t tests where * P < 0.05; ** P < 0.01; *** P < 0.001. Comparison between shRNA Scramble and ShRNA- sh3kbp1 ( n = 8; biological replicates) for the “4–6” nuclei category P = 0.000014, for the “7–9” nuclei category P = 0.039, for the “10–15” nuclei category P = 0.00016 and for the “+ 15” nuclei category P = 0.004. Comparison between ShRNA- sh3kbp1 and ShRNA- sh3kbp1 + SH3KBP1 ( n = 3; biological replicates) for the “4–6” nuclei category P = 0.00008, for the “10–15” nuclei category P = 0.0076 and for the “+ 15” nuclei category P = 0.04. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values.
C2c12 Myotubes, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+c2c12+myoblast+culture+mouse+c2c12+myoblasts/Bafilomycin+A1/pmc12019163-411-8-12
Average 99 stars, based on 1 article reviews
c2c12 myotubes - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

90
BioResource International Inc c2c12 mouse adherent myoblasts
IL-6 and IL-33 may synergistically cause muscle atrophy. (a) The quadriceps muscle of the mice was homogenized, and the lysate was analyzed by Western blotting with specific antibodies against STAT3, AMPK, and Atrogin-1. (b) <t>C2C12</t> cells, mouse adherent myoblasts, were incubated with 2% horse serum for 72 hours and stimulated with recombinant mouse IL-6 and IL-33 in serum-free medium as indicated for 24 hours. The remaining cells were harvested, and the levels of p-STAT3, STAT3, p-AMPK α , and AMPK α in the cell lysate were analyzed by Western blotting. α -Tubulin and GAPDH were used as internal controls. The intensity of bands in the Western blots was measured by ImageJ software. The quantitative data were expressed as the means ± SD. ∗ p < 0.05 compared with control.
C2c12 Mouse Adherent Myoblasts, supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+c2c12+myoblast+culture+mouse+c2c12+myoblasts/c2c12+cells/pmc06458868-33-0-8
Average 90 stars, based on 1 article reviews
c2c12 mouse adherent myoblasts - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
KAC Co Ltd mouse c2c12 myoblasts
IL-6 and IL-33 may synergistically cause muscle atrophy. (a) The quadriceps muscle of the mice was homogenized, and the lysate was analyzed by Western blotting with specific antibodies against STAT3, AMPK, and Atrogin-1. (b) <t>C2C12</t> cells, mouse adherent myoblasts, were incubated with 2% horse serum for 72 hours and stimulated with recombinant mouse IL-6 and IL-33 in serum-free medium as indicated for 24 hours. The remaining cells were harvested, and the levels of p-STAT3, STAT3, p-AMPK α , and AMPK α in the cell lysate were analyzed by Western blotting. α -Tubulin and GAPDH were used as internal controls. The intensity of bands in the Western blots was measured by ImageJ software. The quantitative data were expressed as the means ± SD. ∗ p < 0.05 compared with control.
Mouse C2c12 Myoblasts, supplied by KAC Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+c2c12+myoblast+culture+mouse+c2c12+myoblasts/c2c12+cells/pm35400696-40-3-11
Average 90 stars, based on 1 article reviews
mouse c2c12 myoblasts - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

95
Santa Cruz Biotechnology c2c12 cells
Fig. 1. Expression and subcellular localization of TRPC1 in <t>C2C12</t> myoblasts. (A) Transient receptor potential canonical (TRPC) channel mRNA isoforms in C2C12 myoblasts. Lanes show amplified products of RT-PCR reactions. Total RNA (1 μg) obtained from C2C12 myoblasts was retro-transcripted and cDNA amplified as described in Materials and Methods. The PCR products were visualized on an ethidium-bromide- stained agarose gel. Data are representative of three independent experiments. β-actin amplification, used as an internal control, is shown. (B) TRPC1 expression in subcellular fractions of C2C12 myoblasts. Aliquots of proteins (25 μg) from cell lysates (Lys), cytosol (cyt), Triton-soluble (Ms) or Triton-insoluble (Mi) membrane were processed for western blotting analysis. A blot representative of three is shown. (C) Effect of TRPC1 silencing on channel expression. C2C12 myoblasts were transfected with SCR-siRNA (–) and TRPC1- siRNA (+) as described in Materials and Methods. Aliquots of proteins (30 μg) from cell lysate were subjected to western blotting analysis. A blot representative of three independent experiments with similar results is shown. Band intensity is reported as relative percentage with s.e.m. less than 15%. (D) Confocal immunofluorescence analysis of TRPC1 cell localization. C2C12 cells were grown on glass coverslips, fixed and stained with the primary antibody against TRPC1 (green). The cells were counterstained with TRITC-phalloidin (red) to reveal actin filaments. In the inset, a superimposed fluorescence and DIC image shows co-localization of TRPC1 with TRITC-conjugated WGA at the cell surface. Note that the immunostaining is markedly reduced in TRPC1-silenced cells compared with native and SCR-siRNA treated ones. The images are representative of at least three independent experiments with similar results.
C2c12 Cells, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+c2c12+myoblast+culture+mouse+c2c12+myoblasts/C2C12+Whole+Cell+Lysate/pm19351713-205-0-26
Average 95 stars, based on 1 article reviews
c2c12 cells - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

90
DS Pharma Biomedical c2c12 mouse myoblasts
IRE1 is required in <t>C2C12</t> differentiation. ( a ) IRE1-knockdown cell lines #1, #2, and mock cells were evaluated for the expression of IRE1/ Ern1 mRNA. Results are means + SEM (three biological replicates). ** p < 0.01. ( b ) Differentiation was induced in IRE1-knockdown cell lines and mock cells. After 48 h, cells were observed under phase contrast. Black arrows show the immature myotubes. Scale bar = 100 µm. ( c , d ) Cells were harvested after differentiation induction at 48 h. mRNA expression of myogenic factors ( c ) and UPR relative factors ( d ) was analyzed by qPCR. Results are means + SEM (three biological replicates). * p < 0.05, ** p < 0.01.
C2c12 Mouse Myoblasts, supplied by DS Pharma Biomedical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+c2c12+myoblast+culture+mouse+c2c12+myoblasts/c2c12+myoblasts/pmc06981822-148-0-6
Average 90 stars, based on 1 article reviews
c2c12 mouse myoblasts - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

97
ATCC mouse c2c12 cells
IRE1 is required in <t>C2C12</t> differentiation. ( a ) IRE1-knockdown cell lines #1, #2, and mock cells were evaluated for the expression of IRE1/ Ern1 mRNA. Results are means + SEM (three biological replicates). ** p < 0.01. ( b ) Differentiation was induced in IRE1-knockdown cell lines and mock cells. After 48 h, cells were observed under phase contrast. Black arrows show the immature myotubes. Scale bar = 100 µm. ( c , d ) Cells were harvested after differentiation induction at 48 h. mRNA expression of myogenic factors ( c ) and UPR relative factors ( d ) was analyzed by qPCR. Results are means + SEM (three biological replicates). * p < 0.05, ** p < 0.01.
Mouse C2c12 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+c2c12+myoblast+culture+mouse+c2c12+myoblasts/C2C12+Scrambled/pmc08044108-266-18-21
Average 97 stars, based on 1 article reviews
mouse c2c12 cells - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

97
ATCC mouse c2c12 myoblasts
IRE1 is required in <t>C2C12</t> differentiation. ( a ) IRE1-knockdown cell lines #1, #2, and mock cells were evaluated for the expression of IRE1/ Ern1 mRNA. Results are means + SEM (three biological replicates). ** p < 0.01. ( b ) Differentiation was induced in IRE1-knockdown cell lines and mock cells. After 48 h, cells were observed under phase contrast. Black arrows show the immature myotubes. Scale bar = 100 µm. ( c , d ) Cells were harvested after differentiation induction at 48 h. mRNA expression of myogenic factors ( c ) and UPR relative factors ( d ) was analyzed by qPCR. Results are means + SEM (three biological replicates). * p < 0.05, ** p < 0.01.
Mouse C2c12 Myoblasts, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+c2c12+myoblast+culture+mouse+c2c12+myoblasts/C2C12%3B+Muscle+Myoblast%3B+Mouse/pm20034101-160-0-6
Average 97 stars, based on 1 article reviews
mouse c2c12 myoblasts - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

90
FUJIFILM c2c12 cell line (myoblast-like cell line from the c3h mouse)
Myosin heavy chain (MyHC) expression in parental <t>C2C12</t> cells and C2C12-derived cells permanently expressing Wnt4. Parental C2C12 cells (a, b, e, and f) and W4-08 cells (c, d, g, and h) were cultured for 2 days in proliferation medium containing 10% fetal bovine serum (a–d), or in differentiation medium containing 2% horse serum (e–h), and then immunohistochemically stained with anti-MyHC antibodies, followed by counterstaining with DAPI. Spontaneous expression of slow-type MyHC was evident in W4-08 cells in proliferation medium and intensified in differentiation medium, although the proliferation rates were greatly reduced compared to those of the parental C2C12 cells, as observed in the reduced number of nuclei (blue).
C2c12 Cell Line (Myoblast Like Cell Line From The C3h Mouse), supplied by FUJIFILM, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+c2c12+myoblast+culture+mouse+c2c12+myoblasts/tbhq/pmc03705783-82-1-19
Average 90 stars, based on 1 article reviews
c2c12 cell line (myoblast-like cell line from the c3h mouse) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

94
Genecopoeia c2c12 cells
Myosin heavy chain (MyHC) expression in parental <t>C2C12</t> cells and C2C12-derived cells permanently expressing Wnt4. Parental C2C12 cells (a, b, e, and f) and W4-08 cells (c, d, g, and h) were cultured for 2 days in proliferation medium containing 10% fetal bovine serum (a–d), or in differentiation medium containing 2% horse serum (e–h), and then immunohistochemically stained with anti-MyHC antibodies, followed by counterstaining with DAPI. Spontaneous expression of slow-type MyHC was evident in W4-08 cells in proliferation medium and intensified in differentiation medium, although the proliferation rates were greatly reduced compared to those of the parental C2C12 cells, as observed in the reduced number of nuclei (blue).
C2c12 Cells, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+c2c12+myoblast+culture+mouse+c2c12+myoblasts/Human+cell+line+C2C12+stably+expressing+CRISPR+Cas9%2C+randomly+inserted%2C+single+clone/pm29175376-52-3-28
Average 94 stars, based on 1 article reviews
c2c12 cells - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

95
ATCC mouse myoblast c2c12 cells
(A) ERMS cells were infected with CHIKV at 1 MOI. At 0 h pi, the cell culture medium was supplemented with WFA (1 μM) or the vehicle DMSO (control). The total RNA was isolated at different times pi to quantify the intracellular viral RNA levels by qRT-PCR. The relative levels of the CHIKV RNA are shown in the left panel, where the CHIKV RNA level at 6 h pi in the control was taken as 1. The culture supernatant from the CHIKV-infected cells was collected, and the virus titers determined by the plaque assay are shown in the right panel. (B) ERMS cells infected with CHIKV (1 MOI) were treated with different concentrations of WFA. The cells were processed at 6 h pi for the intracellular viral RNA quantitation by qRT-PCR and cell viability by the MTT assay. The line graph demonstrating the relative viral RNA levels and per cent cell viability at the indicated WFA concentrations is shown. The viral RNA levels and per cent cell viability were normalized to the respective vehicle-only controls. (C) HeLa, Huh7, or <t>C2C12</t> cells were infected with CHIKV (MOI 1) in the presence of WFA or DMSO (vehicle control), and the total RNA was isolated at 6 h pi. The relative CHIKV RNA levels determined by qRT-PCR are presented where the level of CHIKV RNA in the control cells was taken as 1. The student’s t-test was used to calculate the p values; * p <0.05, ** p <0.01, *** p <0.001.
Mouse Myoblast C2c12 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+c2c12+myoblast+culture+mouse+c2c12+myoblasts/L5178-R/pmc11723598-48-7-11
Average 95 stars, based on 1 article reviews
mouse myoblast c2c12 cells - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

99
ATCC human breast raw264 7 atcc tib 71 mouse macrophage cos07 atcc crl 1651 monkey kidney c2c12 atcc crl 1772 mouse myoblast rko atcc crl
(A) ERMS cells were infected with CHIKV at 1 MOI. At 0 h pi, the cell culture medium was supplemented with WFA (1 μM) or the vehicle DMSO (control). The total RNA was isolated at different times pi to quantify the intracellular viral RNA levels by qRT-PCR. The relative levels of the CHIKV RNA are shown in the left panel, where the CHIKV RNA level at 6 h pi in the control was taken as 1. The culture supernatant from the CHIKV-infected cells was collected, and the virus titers determined by the plaque assay are shown in the right panel. (B) ERMS cells infected with CHIKV (1 MOI) were treated with different concentrations of WFA. The cells were processed at 6 h pi for the intracellular viral RNA quantitation by qRT-PCR and cell viability by the MTT assay. The line graph demonstrating the relative viral RNA levels and per cent cell viability at the indicated WFA concentrations is shown. The viral RNA levels and per cent cell viability were normalized to the respective vehicle-only controls. (C) HeLa, Huh7, or <t>C2C12</t> cells were infected with CHIKV (MOI 1) in the presence of WFA or DMSO (vehicle control), and the total RNA was isolated at 6 h pi. The relative CHIKV RNA levels determined by qRT-PCR are presented where the level of CHIKV RNA in the control cells was taken as 1. The student’s t-test was used to calculate the p values; * p <0.05, ** p <0.01, *** p <0.001.
Human Breast Raw264 7 Atcc Tib 71 Mouse Macrophage Cos07 Atcc Crl 1651 Monkey Kidney C2c12 Atcc Crl 1772 Mouse Myoblast Rko Atcc Crl, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+c2c12+myoblast+culture+mouse+c2c12+myoblasts/COS-7/us09890355-205-28-31
Average 99 stars, based on 1 article reviews
human breast raw264 7 atcc tib 71 mouse macrophage cos07 atcc crl 1651 monkey kidney c2c12 atcc crl 1772 mouse myoblast rko atcc crl - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

Image Search Results


VLDL induces ER stress and inflammation. Mouse C2C12 myotubes were incubated in the presence (black bars) or absence (control, Ct, white bars) of 300 μg/ml VLDL for 24 h. (a) mRNA abundance of Bip, Chop and Nqo1. mRNA levels are normalised to Aprt (n = 8–10, five independent C2C12 cultures were used). (b) BiP, phospho-eIF2α (Ser51), TRB3, CHOP and β-actin protein levels. (c), mRNA abundance of Il6, Mcp1, Tnfα, IκBα and Socs3. (d) IκBα, p65 and β-actin protein levels. (e) Phospho-STAT3 (Tyr705), SOCS3 and β-actin protein levels. The graphs show quantification expressed as a percentage of control samples. Data are means ± SD of five independent experiments and were compared by Student’s t test. *p < 0.05, **p < 0.01 and ***p < 0.001 vs control

Journal: Diabetologia

Article Title: VLDL and apolipoprotein CIII induce ER stress and inflammation and attenuate insulin signalling via Toll-like receptor 2 in mouse skeletal muscle cells

doi: 10.1007/s00125-017-4401-5

Figure Lengend Snippet: VLDL induces ER stress and inflammation. Mouse C2C12 myotubes were incubated in the presence (black bars) or absence (control, Ct, white bars) of 300 μg/ml VLDL for 24 h. (a) mRNA abundance of Bip, Chop and Nqo1. mRNA levels are normalised to Aprt (n = 8–10, five independent C2C12 cultures were used). (b) BiP, phospho-eIF2α (Ser51), TRB3, CHOP and β-actin protein levels. (c), mRNA abundance of Il6, Mcp1, Tnfα, IκBα and Socs3. (d) IκBα, p65 and β-actin protein levels. (e) Phospho-STAT3 (Tyr705), SOCS3 and β-actin protein levels. The graphs show quantification expressed as a percentage of control samples. Data are means ± SD of five independent experiments and were compared by Student’s t test. *p < 0.05, **p < 0.01 and ***p < 0.001 vs control

Article Snippet: Cell culture Mouse mycoplasma free C2C12 cells (ATCC, Manassas, VA, USA) were maintained, grown and differentiated to myotubes as previously described [ 15 ].

Techniques: Incubation, Control

VLDL reduces PGC-1α and AMPK levels and induces insulin resistance. Mouse C2C12 myotubes were incubated in the presence (black bars) or absence (control, Ct, white bars) of 300 μg/ml VLDL for 24 h. (a) Pgc1α, Pparα (Ppara), Pparβ/δ (Pparb/Ppard), Acox and Mcad mRNA levels (n = 8–10, five independent C2C12 cultures were used). (b) PGC-1α, NRF1, phospho-AMPK (Thr172), phospho-ACC (Ser79) and β-actin protein levels. (c) NQO1, NRF2 and β-actin protein levels. (d) IRβ, phospho-IRS-1 (Ser307), and β-actin protein levels. (e) Phospho-Akt (Ser473) protein levels. Where indicated, cells were incubated with 100 nmol/l insulin (Ins, I) for the last 10 min. The graphs show quantification expressed as a percentage of control samples. Data are means ± SD of five independent experiments and compared by Student’s t test (a–d) or two-way ANOVA followed by Tukey post hoc test (e). **p < 0.01 and ***p < 0.001 vs control; †††p < 0.001 vs control cells incubated with insulin

Journal: Diabetologia

Article Title: VLDL and apolipoprotein CIII induce ER stress and inflammation and attenuate insulin signalling via Toll-like receptor 2 in mouse skeletal muscle cells

doi: 10.1007/s00125-017-4401-5

Figure Lengend Snippet: VLDL reduces PGC-1α and AMPK levels and induces insulin resistance. Mouse C2C12 myotubes were incubated in the presence (black bars) or absence (control, Ct, white bars) of 300 μg/ml VLDL for 24 h. (a) Pgc1α, Pparα (Ppara), Pparβ/δ (Pparb/Ppard), Acox and Mcad mRNA levels (n = 8–10, five independent C2C12 cultures were used). (b) PGC-1α, NRF1, phospho-AMPK (Thr172), phospho-ACC (Ser79) and β-actin protein levels. (c) NQO1, NRF2 and β-actin protein levels. (d) IRβ, phospho-IRS-1 (Ser307), and β-actin protein levels. (e) Phospho-Akt (Ser473) protein levels. Where indicated, cells were incubated with 100 nmol/l insulin (Ins, I) for the last 10 min. The graphs show quantification expressed as a percentage of control samples. Data are means ± SD of five independent experiments and compared by Student’s t test (a–d) or two-way ANOVA followed by Tukey post hoc test (e). **p < 0.01 and ***p < 0.001 vs control; †††p < 0.001 vs control cells incubated with insulin

Article Snippet: Cell culture Mouse mycoplasma free C2C12 cells (ATCC, Manassas, VA, USA) were maintained, grown and differentiated to myotubes as previously described [ 15 ].

Techniques: Incubation, Control

ERK1/2 inhibition and knockdown prevents the effects of VLDL. (a) C2C12 myotubes (MT) and isolated skeletal muscles (SM) were in-cubated in the presence (black bars) or absence (control, Ct, white bars) of 300 μg/ml VLDL (myotubes) or 500 μg/ml VLDL (muscle) and the protein levels of phospho-ERK1/2 (Thr202/Tyr204) were analysed. (b, c) C2C12 myotubes were incubated in the presence (black bars) or absence (control, white bars) of 300 μg/ml VLDL for 24 h; 10 μmol/l U0126 was added to control (light grey bars) or VLDL-treated (dark grey bars) myotubes and the mRNA abundance of Bip, Chop, Nqo1, Il6, Mcp1 and Tnfα (b) and Pgc1α, Pparα, Pparβ/δ, Acox and Mcad (c) was evaluated. (d, e) C2C12 cells were transfected with control siRNA or ERK1/2siRNA and incubated in the presence or absence of 300 μg/ml VLDL. The mRNA abundance of Bip, Chop, Il6, Mcp1 and Tnfα (d) and Pgc1α, Pparα, Acox and Mcad (e) was evaluated. White bars, control siRNA; light grey bars ERK1/2 siRNA; black bars VLDL + control siRNA; dark grey bars VLDL+ERK1/2 siRNA. The graphs show quantification expressed as a percentage of control. Data are means ± SD of five independent experiments and were compared by Student’s t test (a) or two-way ANOVA followed by Tukey post hoc test (b–e). *p < 0.05, **p < 0.01 and ***p < 0.001 vs control; †††p < 0.001 vs VLDL-exposed cells

Journal: Diabetologia

Article Title: VLDL and apolipoprotein CIII induce ER stress and inflammation and attenuate insulin signalling via Toll-like receptor 2 in mouse skeletal muscle cells

doi: 10.1007/s00125-017-4401-5

Figure Lengend Snippet: ERK1/2 inhibition and knockdown prevents the effects of VLDL. (a) C2C12 myotubes (MT) and isolated skeletal muscles (SM) were in-cubated in the presence (black bars) or absence (control, Ct, white bars) of 300 μg/ml VLDL (myotubes) or 500 μg/ml VLDL (muscle) and the protein levels of phospho-ERK1/2 (Thr202/Tyr204) were analysed. (b, c) C2C12 myotubes were incubated in the presence (black bars) or absence (control, white bars) of 300 μg/ml VLDL for 24 h; 10 μmol/l U0126 was added to control (light grey bars) or VLDL-treated (dark grey bars) myotubes and the mRNA abundance of Bip, Chop, Nqo1, Il6, Mcp1 and Tnfα (b) and Pgc1α, Pparα, Pparβ/δ, Acox and Mcad (c) was evaluated. (d, e) C2C12 cells were transfected with control siRNA or ERK1/2siRNA and incubated in the presence or absence of 300 μg/ml VLDL. The mRNA abundance of Bip, Chop, Il6, Mcp1 and Tnfα (d) and Pgc1α, Pparα, Acox and Mcad (e) was evaluated. White bars, control siRNA; light grey bars ERK1/2 siRNA; black bars VLDL + control siRNA; dark grey bars VLDL+ERK1/2 siRNA. The graphs show quantification expressed as a percentage of control. Data are means ± SD of five independent experiments and were compared by Student’s t test (a) or two-way ANOVA followed by Tukey post hoc test (b–e). *p < 0.05, **p < 0.01 and ***p < 0.001 vs control; †††p < 0.001 vs VLDL-exposed cells

Article Snippet: Cell culture Mouse mycoplasma free C2C12 cells (ATCC, Manassas, VA, USA) were maintained, grown and differentiated to myotubes as previously described [ 15 ].

Techniques: Inhibition, Knockdown, Isolation, Muscles, Control, Incubation, Transfection

ApoCIII activates ERK1/2 and induces ER stress, inflammation and insulin resistance. C2C12 myotubes were incubated in the presence (black bars) or absence (control, Ct, white bars) of 100 μg/ml apoCIII for 24 h. (a) Phospho-ERK1/2 (Thr202/Tyr204) protein levels. (b) BiP, phospho-eIF2α (Ser51), TRB3 and β-actin protein levels. (c) mRNA abundance of Pgc1α, Pparα and Pparβ/δ. (d) PGC-1α, NRF1 and β-actin protein levels. (e) Autoradiograph of EMSA performed with a 32P-labelled PPAR nucleotide and crude nuclear protein extract (NE) from C2C12 myotubes. One main specific complex (Compl I) based on competition with a molar excess of unlabelled probe is shown. The supershift assay performed by incubating NE with an antibody (Ab) directed against PPARβ/δ shows a reduction in the band, whereas the band is unchanged by an unrelated antibody against Oct1. (f) IRβ, phospho-IRS-1 (Ser307) and β-actin protein levels. (g) Phosphorylated Akt (Ser473) protein levels. Where indicated, cells were incubated with 100 nmol/l insulin (Ins, I) for the last 10 min. The graphs show quantification expressed as a percentage of control. Data are means ± SD of five independent experiments and were compared by Student’s t test (a–f) or two-way ANOVA followed by Tukey post hoc test (g). *p < 0.05, **p < 0.01 and***p < 0.001 vs control; †††p < 0.001 vs control cells incubated with insulin

Journal: Diabetologia

Article Title: VLDL and apolipoprotein CIII induce ER stress and inflammation and attenuate insulin signalling via Toll-like receptor 2 in mouse skeletal muscle cells

doi: 10.1007/s00125-017-4401-5

Figure Lengend Snippet: ApoCIII activates ERK1/2 and induces ER stress, inflammation and insulin resistance. C2C12 myotubes were incubated in the presence (black bars) or absence (control, Ct, white bars) of 100 μg/ml apoCIII for 24 h. (a) Phospho-ERK1/2 (Thr202/Tyr204) protein levels. (b) BiP, phospho-eIF2α (Ser51), TRB3 and β-actin protein levels. (c) mRNA abundance of Pgc1α, Pparα and Pparβ/δ. (d) PGC-1α, NRF1 and β-actin protein levels. (e) Autoradiograph of EMSA performed with a 32P-labelled PPAR nucleotide and crude nuclear protein extract (NE) from C2C12 myotubes. One main specific complex (Compl I) based on competition with a molar excess of unlabelled probe is shown. The supershift assay performed by incubating NE with an antibody (Ab) directed against PPARβ/δ shows a reduction in the band, whereas the band is unchanged by an unrelated antibody against Oct1. (f) IRβ, phospho-IRS-1 (Ser307) and β-actin protein levels. (g) Phosphorylated Akt (Ser473) protein levels. Where indicated, cells were incubated with 100 nmol/l insulin (Ins, I) for the last 10 min. The graphs show quantification expressed as a percentage of control. Data are means ± SD of five independent experiments and were compared by Student’s t test (a–f) or two-way ANOVA followed by Tukey post hoc test (g). *p < 0.05, **p < 0.01 and***p < 0.001 vs control; †††p < 0.001 vs control cells incubated with insulin

Article Snippet: Cell culture Mouse mycoplasma free C2C12 cells (ATCC, Manassas, VA, USA) were maintained, grown and differentiated to myotubes as previously described [ 15 ].

Techniques: Incubation, Control, Autoradiography

ERK1/2 inhibition prevents the effects of apoCIII on ER stress and inflammation. (a–e) C2C12 myotubes were incubated in the presence (black bars) or absence (control, Ct, white bars) of 100 μg/ml apoCIII for 24 h; 10 μmol/l U0126 was added to control myotubes (light grey bars) or apoCIII-treated myotubes (dark grey bars). (a) mRNA abundance of Bip, Chop, Socs3, Il6, Mcp1 and Tnfα. (b) BiP, phospho-eIF2α (Ser51), phospho-ERK1/2 (Thr202/Tyr204) and β-actin protein levels. (c) IκBα, NRF2, phospho-STAT3 (Tyr705) and β-actin protein levels. (d) mRNA abundance of Pgc1α, Pparα, Pparβ/δ, Acox and Mcad. (e) PGC-1α, phospho-AMPK (Thr172), phospho-ACC (Ser79) and β-actin protein levels. (f, g) C2C12 myotubes were transfected with control or ERK1/2 siRNA and incubated in the presence or absence of 100 μg/ml apoCIII for 24 h. The mRNA abundance of Bip, Chop, Il6, Mcp1 and Tnfα (f) and Pgc-1α, Pparα, Pparβ/δ, Acox and Mcad (g) was evaluated. White bars, control siRNA; light grey bars ERK1/2 siRNA; black bars, apoCIII+ control siRNA; dark grey bars, apoCIII+ERK1/2 siRNA The graphs show quantification expressed as a percentage of control. Data are means ± SD of five independent experiments and were compared by two-way ANOVA followed by Tukey post hoc test. *p < 0.05, **p < 0.01 and ***p < 0.001 vs control; ††p < 0.01 and †††p < 0.001 vs apoCIII-exposed cells

Journal: Diabetologia

Article Title: VLDL and apolipoprotein CIII induce ER stress and inflammation and attenuate insulin signalling via Toll-like receptor 2 in mouse skeletal muscle cells

doi: 10.1007/s00125-017-4401-5

Figure Lengend Snippet: ERK1/2 inhibition prevents the effects of apoCIII on ER stress and inflammation. (a–e) C2C12 myotubes were incubated in the presence (black bars) or absence (control, Ct, white bars) of 100 μg/ml apoCIII for 24 h; 10 μmol/l U0126 was added to control myotubes (light grey bars) or apoCIII-treated myotubes (dark grey bars). (a) mRNA abundance of Bip, Chop, Socs3, Il6, Mcp1 and Tnfα. (b) BiP, phospho-eIF2α (Ser51), phospho-ERK1/2 (Thr202/Tyr204) and β-actin protein levels. (c) IκBα, NRF2, phospho-STAT3 (Tyr705) and β-actin protein levels. (d) mRNA abundance of Pgc1α, Pparα, Pparβ/δ, Acox and Mcad. (e) PGC-1α, phospho-AMPK (Thr172), phospho-ACC (Ser79) and β-actin protein levels. (f, g) C2C12 myotubes were transfected with control or ERK1/2 siRNA and incubated in the presence or absence of 100 μg/ml apoCIII for 24 h. The mRNA abundance of Bip, Chop, Il6, Mcp1 and Tnfα (f) and Pgc-1α, Pparα, Pparβ/δ, Acox and Mcad (g) was evaluated. White bars, control siRNA; light grey bars ERK1/2 siRNA; black bars, apoCIII+ control siRNA; dark grey bars, apoCIII+ERK1/2 siRNA The graphs show quantification expressed as a percentage of control. Data are means ± SD of five independent experiments and were compared by two-way ANOVA followed by Tukey post hoc test. *p < 0.05, **p < 0.01 and ***p < 0.001 vs control; ††p < 0.01 and †††p < 0.001 vs apoCIII-exposed cells

Article Snippet: Cell culture Mouse mycoplasma free C2C12 cells (ATCC, Manassas, VA, USA) were maintained, grown and differentiated to myotubes as previously described [ 15 ].

Techniques: Inhibition, Incubation, Control, Transfection

TLR2 mediates the effects of apoCIII on ERK1/2, ER stress and inflammation. Mouse C2C12 myotubes were incubated in the presence or absence (control, Ct, white bars) of 100 μg/ml apoCIII for 24 h; 50 μg/ml of IgG was added to apoCIII-treated myotubes (black bars) or 50 μg/ml of the neutralising antibody against TLR2 (TLR2NAb) was added to the control (light grey bars) or apoCIII-treated (dark grey bars) myotubes. (a) Phospho-ERK1/2 (Thr202/Tyr204) protein levels. (b) mRNA abundance of Bip, Chop, Il6, Mcp1 and Tnfα. (c) BiP, phospho-eIF2α (Ser51), IκBα, and β-actin protein levels. (d) IRβ, phospho-IRS-1 (Ser307) and β-actin protein levels. (e) PGC-1α, NRF1 and β-actin protein levels. (f) mRNA abundance of Pgc1α, Pparα, Acox and Mcad mRNA. The graphs show quantification expressed as a percentage of control. Data are means ± SD of five independent experiments and were compared by two-way ANOVA followed by Tukey post hoc test. *p < 0.05, **p < 0.01 and ***p < 0.001 vs control; ††p < 0.01 and †††p < 0.001 vs apoCIII-exposed cells

Journal: Diabetologia

Article Title: VLDL and apolipoprotein CIII induce ER stress and inflammation and attenuate insulin signalling via Toll-like receptor 2 in mouse skeletal muscle cells

doi: 10.1007/s00125-017-4401-5

Figure Lengend Snippet: TLR2 mediates the effects of apoCIII on ERK1/2, ER stress and inflammation. Mouse C2C12 myotubes were incubated in the presence or absence (control, Ct, white bars) of 100 μg/ml apoCIII for 24 h; 50 μg/ml of IgG was added to apoCIII-treated myotubes (black bars) or 50 μg/ml of the neutralising antibody against TLR2 (TLR2NAb) was added to the control (light grey bars) or apoCIII-treated (dark grey bars) myotubes. (a) Phospho-ERK1/2 (Thr202/Tyr204) protein levels. (b) mRNA abundance of Bip, Chop, Il6, Mcp1 and Tnfα. (c) BiP, phospho-eIF2α (Ser51), IκBα, and β-actin protein levels. (d) IRβ, phospho-IRS-1 (Ser307) and β-actin protein levels. (e) PGC-1α, NRF1 and β-actin protein levels. (f) mRNA abundance of Pgc1α, Pparα, Acox and Mcad mRNA. The graphs show quantification expressed as a percentage of control. Data are means ± SD of five independent experiments and were compared by two-way ANOVA followed by Tukey post hoc test. *p < 0.05, **p < 0.01 and ***p < 0.001 vs control; ††p < 0.01 and †††p < 0.001 vs apoCIII-exposed cells

Article Snippet: Cell culture Mouse mycoplasma free C2C12 cells (ATCC, Manassas, VA, USA) were maintained, grown and differentiated to myotubes as previously described [ 15 ].

Techniques: Incubation, Control

( A ) Western blot analysis of SH3KBP1 protein levels in total protein extracts obtained from growing (GM) or differentiating C2C12 cells (from 1 to 5 days). C2C12 differentiation is assessed by Myogenin expression and Tubulin is used as loading control. ( B ) RT-qPCR analysis of Sh3kbp1 gene expression level relative to housekeeping genes ( CycloB, Gapdh, GusB, Rpl41 , and Tbp ) in proliferating C2C12 cells (GM) or in differentiating C2C12 (1 to 5 days of differentiation). ( C ) Representative western blots analysis of SH3KBP1 protein downregulation in stable cell line constitutively expressing shRNA construct targeting Sh3kbp1 . Tubulin is used as loading control. ( D , E ) Representative immunofluorescence staining of myosin heavy chain (green) and myonuclei (red) in C2C12 stable cell lines expressing scramble shRNA ( D ) or shRNA targeting Sh3kbp1 ( E ) after 3 or 6 days of differentiation. Zooms are magnifications of images in white dots rectangles in 6 days old myotubes. Scale bars: 150 µm, 15 µm in zoom. ( F , G ) Representatives immunofluorescent staining of myosin heavy chain (green) and myonuclei (red) in stable cell line expressing Sh3kbp1 shRNA, co-transfected with plasmid coding either for mCherry ( F ) or the full-length human SH3KBP1 ( G ) after 5 days of differentiation. Scale bar: 150 µm. ( H ) Quantification of the percentage of myonuclei per clusters observed in ( D – G ) experiments. Statistical analysis performed using unpaired t tests where * P < 0.05; ** P < 0.01; *** P < 0.001. Comparison between shRNA Scramble and ShRNA- sh3kbp1 ( n = 8; biological replicates) for the “4–6” nuclei category P = 0.000014, for the “7–9” nuclei category P = 0.039, for the “10–15” nuclei category P = 0.00016 and for the “+ 15” nuclei category P = 0.004. Comparison between ShRNA- sh3kbp1 and ShRNA- sh3kbp1 + SH3KBP1 ( n = 3; biological replicates) for the “4–6” nuclei category P = 0.00008, for the “10–15” nuclei category P = 0.0076 and for the “+ 15” nuclei category P = 0.04. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values.

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) Western blot analysis of SH3KBP1 protein levels in total protein extracts obtained from growing (GM) or differentiating C2C12 cells (from 1 to 5 days). C2C12 differentiation is assessed by Myogenin expression and Tubulin is used as loading control. ( B ) RT-qPCR analysis of Sh3kbp1 gene expression level relative to housekeeping genes ( CycloB, Gapdh, GusB, Rpl41 , and Tbp ) in proliferating C2C12 cells (GM) or in differentiating C2C12 (1 to 5 days of differentiation). ( C ) Representative western blots analysis of SH3KBP1 protein downregulation in stable cell line constitutively expressing shRNA construct targeting Sh3kbp1 . Tubulin is used as loading control. ( D , E ) Representative immunofluorescence staining of myosin heavy chain (green) and myonuclei (red) in C2C12 stable cell lines expressing scramble shRNA ( D ) or shRNA targeting Sh3kbp1 ( E ) after 3 or 6 days of differentiation. Zooms are magnifications of images in white dots rectangles in 6 days old myotubes. Scale bars: 150 µm, 15 µm in zoom. ( F , G ) Representatives immunofluorescent staining of myosin heavy chain (green) and myonuclei (red) in stable cell line expressing Sh3kbp1 shRNA, co-transfected with plasmid coding either for mCherry ( F ) or the full-length human SH3KBP1 ( G ) after 5 days of differentiation. Scale bar: 150 µm. ( H ) Quantification of the percentage of myonuclei per clusters observed in ( D – G ) experiments. Statistical analysis performed using unpaired t tests where * P < 0.05; ** P < 0.01; *** P < 0.001. Comparison between shRNA Scramble and ShRNA- sh3kbp1 ( n = 8; biological replicates) for the “4–6” nuclei category P = 0.000014, for the “7–9” nuclei category P = 0.039, for the “10–15” nuclei category P = 0.00016 and for the “+ 15” nuclei category P = 0.004. Comparison between ShRNA- sh3kbp1 and ShRNA- sh3kbp1 + SH3KBP1 ( n = 3; biological replicates) for the “4–6” nuclei category P = 0.00008, for the “10–15” nuclei category P = 0.0076 and for the “+ 15” nuclei category P = 0.04. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Western Blot, Expressing, Control, Quantitative RT-PCR, Gene Expression, Stable Transfection, shRNA, Construct, Immunofluorescence, Staining, Transfection, Plasmid Preparation, Comparison, Software

( A ) Representative immunofluorescence staining of 5 days C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA and stained with sirTubulin ® . Scale bars, 10 µm. ( B ) Quantification of the microtubule bundle directionality (orientation angle normalized according to myotubes longitudinal axis) in myotubes using the “directionality plugin” of ImageJ ® . Data are pooled from three independent repeats ( n = 41 cells in scramble condition and n = 61 cells in Sh3kbp1 shRNA condition). “−90°” category P = 0.03; “+80°” category P = 0.02“ + 90°” category P = 0.017. Statistical analysis performed using unpaired t tests where * P < 0.05. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( C, D ) Representative images of immunofluorescent staining of Pericentrin (red), PCM1 (green) and nuclei (Blue) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Scale bars, 10 µm. ( E , F ) Quantification of the myonuclei peripheral staining of Pericentrin ( E ) or PCM1 ( F ) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Data are pooled from three independent repeats. Error bars represent SD ( G ) MAP7 constructs used in the experiment. ( H ) Representative western blot of crude extracts of C2C12 cells expressing various GFP-MAP7 constructs (FL: Full length, NT: N-terminal part of MAP7; NTL: N-terminal long part of MAP7; M: Middle part of MAP7, CT: C-terminal part of MAP7 and CTL: C-terminal long part of MAP7) and GFP-DNM2 and stained for endogenous SH3KBP1 (top) or with anti-GFP (bottom) antibodies. ( I ) Representative western blot after GFP immunoprecipitation (MAP7 and DNM2 constructs) using GFP-Trap in C2C12 cell extracts ( H ). The membrane was revealed with anti-GFP (bottom) and anti-SH3KBP1 (Top) antibodies n .>3.

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) Representative immunofluorescence staining of 5 days C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA and stained with sirTubulin ® . Scale bars, 10 µm. ( B ) Quantification of the microtubule bundle directionality (orientation angle normalized according to myotubes longitudinal axis) in myotubes using the “directionality plugin” of ImageJ ® . Data are pooled from three independent repeats ( n = 41 cells in scramble condition and n = 61 cells in Sh3kbp1 shRNA condition). “−90°” category P = 0.03; “+80°” category P = 0.02“ + 90°” category P = 0.017. Statistical analysis performed using unpaired t tests where * P < 0.05. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( C, D ) Representative images of immunofluorescent staining of Pericentrin (red), PCM1 (green) and nuclei (Blue) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Scale bars, 10 µm. ( E , F ) Quantification of the myonuclei peripheral staining of Pericentrin ( E ) or PCM1 ( F ) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Data are pooled from three independent repeats. Error bars represent SD ( G ) MAP7 constructs used in the experiment. ( H ) Representative western blot of crude extracts of C2C12 cells expressing various GFP-MAP7 constructs (FL: Full length, NT: N-terminal part of MAP7; NTL: N-terminal long part of MAP7; M: Middle part of MAP7, CT: C-terminal part of MAP7 and CTL: C-terminal long part of MAP7) and GFP-DNM2 and stained for endogenous SH3KBP1 (top) or with anti-GFP (bottom) antibodies. ( I ) Representative western blot after GFP immunoprecipitation (MAP7 and DNM2 constructs) using GFP-Trap in C2C12 cell extracts ( H ). The membrane was revealed with anti-GFP (bottom) and anti-SH3KBP1 (Top) antibodies n .>3.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Immunofluorescence, Staining, Expressing, shRNA, Software, Construct, Western Blot, Immunoprecipitation, Membrane

( A ) SH3KBP1 constructs used in the experiment. ( B ) Representative western blot of crude extracts of C2C12 cells co-expressing GFP-DNM2 and various Flag-SH3KBP1 constructs (FL full length, N-term N-terminal part of SH3KBP1, C-term C-terminal part of SH3KBP1) and stained with anti-GFP (top) or anti-Flag (bottom) antibodies. ( C ) Representative western blot after DNM2-GFP immunoprecipitation using GFP-Trap and aforementioned C2C12 cell extracts ( B ). The membrane was revealed with anti-GFP (top), anti-Flag (middle) and anti-SH3KBP1 (bottom) antibodies. ( B , C ) Blots were repeated more than three times. ( D ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DNM2 (red) and myonuclei (blue) (single Z plan). Scale bars, 10 µm. ( E ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DHPR1α (for DyHydroPyridine Receptor alpha, red) and myonuclei (blue) (Max intensity of Z stacks plans). Scale bars, 10 µm. ( F ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue) in the time course of C2C12 cells differentiation: proliferation (Prolif) and 3 or 5 days of differentiation (diff day 3, diff day 5) are presented. ( G ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue or red) along the time course of primary myoblasts cells differentiation: proliferation (Prolif) and 3 or 10 days of differentiation (diff day 3, diff day 10) are presented. Scale bars, 10 µm.

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) SH3KBP1 constructs used in the experiment. ( B ) Representative western blot of crude extracts of C2C12 cells co-expressing GFP-DNM2 and various Flag-SH3KBP1 constructs (FL full length, N-term N-terminal part of SH3KBP1, C-term C-terminal part of SH3KBP1) and stained with anti-GFP (top) or anti-Flag (bottom) antibodies. ( C ) Representative western blot after DNM2-GFP immunoprecipitation using GFP-Trap and aforementioned C2C12 cell extracts ( B ). The membrane was revealed with anti-GFP (top), anti-Flag (middle) and anti-SH3KBP1 (bottom) antibodies. ( B , C ) Blots were repeated more than three times. ( D ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DNM2 (red) and myonuclei (blue) (single Z plan). Scale bars, 10 µm. ( E ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DHPR1α (for DyHydroPyridine Receptor alpha, red) and myonuclei (blue) (Max intensity of Z stacks plans). Scale bars, 10 µm. ( F ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue) in the time course of C2C12 cells differentiation: proliferation (Prolif) and 3 or 5 days of differentiation (diff day 3, diff day 5) are presented. ( G ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue or red) along the time course of primary myoblasts cells differentiation: proliferation (Prolif) and 3 or 10 days of differentiation (diff day 3, diff day 10) are presented. Scale bars, 10 µm.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Construct, Western Blot, Expressing, Staining, Immunoprecipitation, Membrane

( A , B ) Representative Immunofluorescent staining of Golgi (RCAS1, red) ( A ) or Endoplasmic Reticulum (ERP72, red) ( B ) and myonuclei (DAPI, blue) in 6 days differentiated C2C12 cells expressing either scramble-GFP-shRNA or GFP-shRNA targeting Sh3kbp1 gene. Scale bars, 100 µm. Zooms 1–4 are magnifications of the images in white dots. Scale bars: 100 µm. ( C ) GFP-tagged SH3KBP1 constructs used in the experiment. ( D ) Representative western blot performed on crude extracts of C2C12 cells expressing GFP-SH3KBP1 constructs and stained with anti-ERP72 (Top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. ( E ) Representative western blot performed after SH3KBP1-GFP construct immunoprecipitation (GFP trap assay) of C2C12 cells extracts ( D ) and stained with anti-ERP72 (top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. Blots were repeated more than three times. ( F ) Representative immunofluorescent images of GFP-SH3KBP1 constructs expression in 10 days cultured primary myofibers. (GFP, green; Actin, red and myonuclei, blue) Scale bars, 5 µm. ( G ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes, differentiated for 6 days, were analyzed for their content of LC3-I/LC3-II and SH3KBP1 proteins by western blot; Actin labeling was used as a loading control. ( H ) Fold change quantification of LC3-II/Actin ratios reported to the Scramble condition. ( n = 3; biological replicates) P = 0.002. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( I ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes differentiated for 6 days were either left untreated or treated with 100 nM of bafilomycin-A1 during 6 h. After total protein extraction, LC3-I/LC3-II and Actin levels were analyzed by immunoblot. ( J ) Fold change quantification of LC3-II/Actin ratios reported to the untreated condition in each condition (Scramble or Sh3KBP1) ( n = 3; biological replicates) P = 0.0011. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( K ) Quantification of the percentage of highly LC3-II positive myofibers in Tibialis Anterior muscles from WT or KI- Dnm2 R465W/+ injected with either PBS or shRNA targeting SH3KBP1 mRNA ( n > 3; biological replicates). Comparison between WT and WT-ShRNA- sh3kbp1 P = 0.0059, KI-DNM2 R465W and KI-DNM2 R465W -ShRNA- sh3kbp1 P = 0.0056. Statistical analysis performed using unpaired t tests where ** P < 0.01. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( L ) Representative electron microscopy images of myofibrils and triads organization within Flexor digitalis Brevis muscles from WT mice injected with either PBS or AAV cognate vector expressing shRNA targeting SH3KBP1 mRNA. Scale bar = 0.2 µm or 100 nm.

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A , B ) Representative Immunofluorescent staining of Golgi (RCAS1, red) ( A ) or Endoplasmic Reticulum (ERP72, red) ( B ) and myonuclei (DAPI, blue) in 6 days differentiated C2C12 cells expressing either scramble-GFP-shRNA or GFP-shRNA targeting Sh3kbp1 gene. Scale bars, 100 µm. Zooms 1–4 are magnifications of the images in white dots. Scale bars: 100 µm. ( C ) GFP-tagged SH3KBP1 constructs used in the experiment. ( D ) Representative western blot performed on crude extracts of C2C12 cells expressing GFP-SH3KBP1 constructs and stained with anti-ERP72 (Top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. ( E ) Representative western blot performed after SH3KBP1-GFP construct immunoprecipitation (GFP trap assay) of C2C12 cells extracts ( D ) and stained with anti-ERP72 (top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. Blots were repeated more than three times. ( F ) Representative immunofluorescent images of GFP-SH3KBP1 constructs expression in 10 days cultured primary myofibers. (GFP, green; Actin, red and myonuclei, blue) Scale bars, 5 µm. ( G ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes, differentiated for 6 days, were analyzed for their content of LC3-I/LC3-II and SH3KBP1 proteins by western blot; Actin labeling was used as a loading control. ( H ) Fold change quantification of LC3-II/Actin ratios reported to the Scramble condition. ( n = 3; biological replicates) P = 0.002. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( I ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes differentiated for 6 days were either left untreated or treated with 100 nM of bafilomycin-A1 during 6 h. After total protein extraction, LC3-I/LC3-II and Actin levels were analyzed by immunoblot. ( J ) Fold change quantification of LC3-II/Actin ratios reported to the untreated condition in each condition (Scramble or Sh3KBP1) ( n = 3; biological replicates) P = 0.0011. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( K ) Quantification of the percentage of highly LC3-II positive myofibers in Tibialis Anterior muscles from WT or KI- Dnm2 R465W/+ injected with either PBS or shRNA targeting SH3KBP1 mRNA ( n > 3; biological replicates). Comparison between WT and WT-ShRNA- sh3kbp1 P = 0.0059, KI-DNM2 R465W and KI-DNM2 R465W -ShRNA- sh3kbp1 P = 0.0056. Statistical analysis performed using unpaired t tests where ** P < 0.01. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( L ) Representative electron microscopy images of myofibrils and triads organization within Flexor digitalis Brevis muscles from WT mice injected with either PBS or AAV cognate vector expressing shRNA targeting SH3KBP1 mRNA. Scale bar = 0.2 µm or 100 nm.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Staining, Expressing, shRNA, Construct, Western Blot, Immunoprecipitation, TRAP Assay, Cell Culture, Control, Labeling, Protein Extraction, Muscles, Injection, Comparison, Software, Electron Microscopy, Plasmid Preparation

IL-6 and IL-33 may synergistically cause muscle atrophy. (a) The quadriceps muscle of the mice was homogenized, and the lysate was analyzed by Western blotting with specific antibodies against STAT3, AMPK, and Atrogin-1. (b) C2C12 cells, mouse adherent myoblasts, were incubated with 2% horse serum for 72 hours and stimulated with recombinant mouse IL-6 and IL-33 in serum-free medium as indicated for 24 hours. The remaining cells were harvested, and the levels of p-STAT3, STAT3, p-AMPK α , and AMPK α in the cell lysate were analyzed by Western blotting. α -Tubulin and GAPDH were used as internal controls. The intensity of bands in the Western blots was measured by ImageJ software. The quantitative data were expressed as the means ± SD. ∗ p < 0.05 compared with control.

Journal: Mediators of Inflammation

Article Title: Elevation of IL-6 and IL-33 Levels in Serum Associated with Lung Fibrosis and Skeletal Muscle Wasting in a Bleomycin-Induced Lung Injury Mouse Model

doi: 10.1155/2019/7947596

Figure Lengend Snippet: IL-6 and IL-33 may synergistically cause muscle atrophy. (a) The quadriceps muscle of the mice was homogenized, and the lysate was analyzed by Western blotting with specific antibodies against STAT3, AMPK, and Atrogin-1. (b) C2C12 cells, mouse adherent myoblasts, were incubated with 2% horse serum for 72 hours and stimulated with recombinant mouse IL-6 and IL-33 in serum-free medium as indicated for 24 hours. The remaining cells were harvested, and the levels of p-STAT3, STAT3, p-AMPK α , and AMPK α in the cell lysate were analyzed by Western blotting. α -Tubulin and GAPDH were used as internal controls. The intensity of bands in the Western blots was measured by ImageJ software. The quantitative data were expressed as the means ± SD. ∗ p < 0.05 compared with control.

Article Snippet: C2C12 mouse adherent myoblasts were obtained from BCRC (Bioresource Collection and Research Center, Hsinchu, Taiwan).

Techniques: Western Blot, Incubation, Recombinant, Software, Control

Fig. 1. Expression and subcellular localization of TRPC1 in C2C12 myoblasts. (A) Transient receptor potential canonical (TRPC) channel mRNA isoforms in C2C12 myoblasts. Lanes show amplified products of RT-PCR reactions. Total RNA (1 μg) obtained from C2C12 myoblasts was retro-transcripted and cDNA amplified as described in Materials and Methods. The PCR products were visualized on an ethidium-bromide- stained agarose gel. Data are representative of three independent experiments. β-actin amplification, used as an internal control, is shown. (B) TRPC1 expression in subcellular fractions of C2C12 myoblasts. Aliquots of proteins (25 μg) from cell lysates (Lys), cytosol (cyt), Triton-soluble (Ms) or Triton-insoluble (Mi) membrane were processed for western blotting analysis. A blot representative of three is shown. (C) Effect of TRPC1 silencing on channel expression. C2C12 myoblasts were transfected with SCR-siRNA (–) and TRPC1- siRNA (+) as described in Materials and Methods. Aliquots of proteins (30 μg) from cell lysate were subjected to western blotting analysis. A blot representative of three independent experiments with similar results is shown. Band intensity is reported as relative percentage with s.e.m. less than 15%. (D) Confocal immunofluorescence analysis of TRPC1 cell localization. C2C12 cells were grown on glass coverslips, fixed and stained with the primary antibody against TRPC1 (green). The cells were counterstained with TRITC-phalloidin (red) to reveal actin filaments. In the inset, a superimposed fluorescence and DIC image shows co-localization of TRPC1 with TRITC-conjugated WGA at the cell surface. Note that the immunostaining is markedly reduced in TRPC1-silenced cells compared with native and SCR-siRNA treated ones. The images are representative of at least three independent experiments with similar results.

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 1. Expression and subcellular localization of TRPC1 in C2C12 myoblasts. (A) Transient receptor potential canonical (TRPC) channel mRNA isoforms in C2C12 myoblasts. Lanes show amplified products of RT-PCR reactions. Total RNA (1 μg) obtained from C2C12 myoblasts was retro-transcripted and cDNA amplified as described in Materials and Methods. The PCR products were visualized on an ethidium-bromide- stained agarose gel. Data are representative of three independent experiments. β-actin amplification, used as an internal control, is shown. (B) TRPC1 expression in subcellular fractions of C2C12 myoblasts. Aliquots of proteins (25 μg) from cell lysates (Lys), cytosol (cyt), Triton-soluble (Ms) or Triton-insoluble (Mi) membrane were processed for western blotting analysis. A blot representative of three is shown. (C) Effect of TRPC1 silencing on channel expression. C2C12 myoblasts were transfected with SCR-siRNA (–) and TRPC1- siRNA (+) as described in Materials and Methods. Aliquots of proteins (30 μg) from cell lysate were subjected to western blotting analysis. A blot representative of three independent experiments with similar results is shown. Band intensity is reported as relative percentage with s.e.m. less than 15%. (D) Confocal immunofluorescence analysis of TRPC1 cell localization. C2C12 cells were grown on glass coverslips, fixed and stained with the primary antibody against TRPC1 (green). The cells were counterstained with TRITC-phalloidin (red) to reveal actin filaments. In the inset, a superimposed fluorescence and DIC image shows co-localization of TRPC1 with TRITC-conjugated WGA at the cell surface. Note that the immunostaining is markedly reduced in TRPC1-silenced cells compared with native and SCR-siRNA treated ones. The images are representative of at least three independent experiments with similar results.

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: Expressing, Amplification, Reverse Transcription Polymerase Chain Reaction, Staining, Agarose Gel Electrophoresis, Control, Membrane, Western Blot, Transfection, Immunofluorescence, Fluorescence, Immunostaining

Fig. 2. Effect of TRPC1 silencing on stretch-activated Ca2+-transients and SAC currents in C2C12 myoblasts. (A) C2C12 myoblasts were pre-loaded with Fluo3-AM and mechanically stretched with the tip of an AFM probe (thick grey line). Fluorescence images were acquired soon after mechanical stimulation at a rate of 1 image/second using a digital camera. The pseudo- colouring represents the global Ca2+ increase as indicated by the colour bar. Note the marked reduction and the absence of the Ca2+ transient in TRPC1 silenced cells. The images are representative of at least five to six independent experiments with similar results (number of stretched cells for each group=5). (B) Two patch pipettes were attached to the cells at (a) resting length and (b) after 20% cell stretching induced by the movement of the upper pipette in the longitudinal direction. (C) Representative total current traces, (a) Im* recorded in bath solution by whole cell path-clamp; (b) leak current, Im,leak, recorded in the presence of GdCl3 added in the bath solution and (c-j) SAC-mediated current; Im, evaluated by detracting Im,leak from Im*; (c-f) SAC-mediated currents (Im) in SCR- and TRPC1-siRNA cells unstimulated and (g-j) S1P- stimulated evaluated before (c,e,g,i) and after (d,f,h,j) the application of the mechanical stretch; (k,l), currents normalized for Cm elicited by ramp voltage pulses from the same cell reported in panels a-j. siTRPC1, TRPC1-siRNA transfected cells; str, stretched cells.

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 2. Effect of TRPC1 silencing on stretch-activated Ca2+-transients and SAC currents in C2C12 myoblasts. (A) C2C12 myoblasts were pre-loaded with Fluo3-AM and mechanically stretched with the tip of an AFM probe (thick grey line). Fluorescence images were acquired soon after mechanical stimulation at a rate of 1 image/second using a digital camera. The pseudo- colouring represents the global Ca2+ increase as indicated by the colour bar. Note the marked reduction and the absence of the Ca2+ transient in TRPC1 silenced cells. The images are representative of at least five to six independent experiments with similar results (number of stretched cells for each group=5). (B) Two patch pipettes were attached to the cells at (a) resting length and (b) after 20% cell stretching induced by the movement of the upper pipette in the longitudinal direction. (C) Representative total current traces, (a) Im* recorded in bath solution by whole cell path-clamp; (b) leak current, Im,leak, recorded in the presence of GdCl3 added in the bath solution and (c-j) SAC-mediated current; Im, evaluated by detracting Im,leak from Im*; (c-f) SAC-mediated currents (Im) in SCR- and TRPC1-siRNA cells unstimulated and (g-j) S1P- stimulated evaluated before (c,e,g,i) and after (d,f,h,j) the application of the mechanical stretch; (k,l), currents normalized for Cm elicited by ramp voltage pulses from the same cell reported in panels a-j. siTRPC1, TRPC1-siRNA transfected cells; str, stretched cells.

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: Fluorescence, Transferring, Transfection

Fig. 3. Localization of TRPC1 in lipid microdomains of C2C12 myoblasts: effects of cholesterol depletion. (A) Localization of endogenous TRPC1 in lipid microdomains. Lipid-raft (DRM) and high-density (HDM) fractions were prepared as reported in Materials and Methods. An aliquot of each fraction (20 μl, 1/25 of total volume of 1-11 fractions) was resolved by SDS-PAGE and anti-caveolin 1 (Cav1), anti-TRPC1 and anti-calnexin immunodetected. A blot representative of three independent experiments with similar results is reported. (B) Sphingolipid content measurements. Sucrose density gradient fractions were prepared from [3H]sphingosine-labelled cells as described in Materials and Methods. Total radioactivity of unfractionated [3H]sphingolipids was determined in each fraction and reported as mean ± s.e.m. of a representative experiment performed in duplicate with similar results. (C) Co-immunoprecipitation of TRPC1 and Cav1. Pooled DRM fractions (F3-F4) obtained from C2C12 cell fractionation were subjected to immunoprecipitation with rabbit polyclonal antibodies directed against TRPC1 as described in Materials and Methods and Cav1 immunodetected. A blot, representative of two independent experiments, is reported. (D) Confocal immunofluorescent localization of endogenous TRPC1 in lipid rafts (triple labelling). (a,b) Native C2C12 myoblasts and (d,e) C2C12 cells treated with MβCD for 30 minutes were incubated with Alexa Fluor 488-conjugated CT-B (green) to label lipid rafts, immunostained for TRPC1 (red) and (b,e) counterstained with Alexa Fluor 647-labelled phalloidin to reveal actin filaments. Inset: magnification of outlined area. Yellow spots in panels a and d indicate co-localization of red and green fluorescence signals. (c,f) Scatter plots of the distribution of red and green fluorescence intensity signals. Pixel intensity (PI) for each of the dyes along the lines (AB, CD) in the confocal image g are shown. The degree of co-localization of TRPC1 with CT-B is summarized in the histogram. The images are representative of at least three independent experiments with similar results. (E) Effect of lipid-raft disruption on TRPC1 expression. C2C12 myoblasts were pre-incubated for 30 minutes in media containing vehicle (–) and MβCD (+), collected and processed for lipid-raft (DRM) and high-density membrane fraction (showed fraction 11) purification as described in the Materials and Methods. An equal amount (20 μl) of fractions was evaluated for the presence of TRPC1 and Cav1 by western blotting analysis. A blot representative of three is shown. (F) Effect of MβCD treatment on Gm/Cm. C2C12 cells were incubated for 30 minutes with MβCD in the presence or in the absence of S1P. Transmembrane ion conductance and cell capacitance were analysed by whole cell patch clamp in K+-free bath solution. Data are mean ± s.e.m. of 12-15 different recordings (*P<0.05, **P<0.001).

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 3. Localization of TRPC1 in lipid microdomains of C2C12 myoblasts: effects of cholesterol depletion. (A) Localization of endogenous TRPC1 in lipid microdomains. Lipid-raft (DRM) and high-density (HDM) fractions were prepared as reported in Materials and Methods. An aliquot of each fraction (20 μl, 1/25 of total volume of 1-11 fractions) was resolved by SDS-PAGE and anti-caveolin 1 (Cav1), anti-TRPC1 and anti-calnexin immunodetected. A blot representative of three independent experiments with similar results is reported. (B) Sphingolipid content measurements. Sucrose density gradient fractions were prepared from [3H]sphingosine-labelled cells as described in Materials and Methods. Total radioactivity of unfractionated [3H]sphingolipids was determined in each fraction and reported as mean ± s.e.m. of a representative experiment performed in duplicate with similar results. (C) Co-immunoprecipitation of TRPC1 and Cav1. Pooled DRM fractions (F3-F4) obtained from C2C12 cell fractionation were subjected to immunoprecipitation with rabbit polyclonal antibodies directed against TRPC1 as described in Materials and Methods and Cav1 immunodetected. A blot, representative of two independent experiments, is reported. (D) Confocal immunofluorescent localization of endogenous TRPC1 in lipid rafts (triple labelling). (a,b) Native C2C12 myoblasts and (d,e) C2C12 cells treated with MβCD for 30 minutes were incubated with Alexa Fluor 488-conjugated CT-B (green) to label lipid rafts, immunostained for TRPC1 (red) and (b,e) counterstained with Alexa Fluor 647-labelled phalloidin to reveal actin filaments. Inset: magnification of outlined area. Yellow spots in panels a and d indicate co-localization of red and green fluorescence signals. (c,f) Scatter plots of the distribution of red and green fluorescence intensity signals. Pixel intensity (PI) for each of the dyes along the lines (AB, CD) in the confocal image g are shown. The degree of co-localization of TRPC1 with CT-B is summarized in the histogram. The images are representative of at least three independent experiments with similar results. (E) Effect of lipid-raft disruption on TRPC1 expression. C2C12 myoblasts were pre-incubated for 30 minutes in media containing vehicle (–) and MβCD (+), collected and processed for lipid-raft (DRM) and high-density membrane fraction (showed fraction 11) purification as described in the Materials and Methods. An equal amount (20 μl) of fractions was evaluated for the presence of TRPC1 and Cav1 by western blotting analysis. A blot representative of three is shown. (F) Effect of MβCD treatment on Gm/Cm. C2C12 cells were incubated for 30 minutes with MβCD in the presence or in the absence of S1P. Transmembrane ion conductance and cell capacitance were analysed by whole cell patch clamp in K+-free bath solution. Data are mean ± s.e.m. of 12-15 different recordings (*P<0.05, **P<0.001).

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: SDS Page, Radioactivity, Immunoprecipitation, Cell Fractionation, Incubation, Fluorescence, Disruption, Expressing, Membrane, Purification, Western Blot, Patch Clamp

Fig. 4. Effects of stress fibre formation and cytoskeletal integrity on TRPC1-cortactin interaction, channel expression and localization. (A) Co-immunoprecipitation of TRPC1 with cortactin. C2C12 cells were incubated in the presence or absence (–) of 1 μM S1P or of 1 μg/ml DHCB, for 30 minutes and collected in lysis buffer and immunoprecipitation performed as reported in the Materials and Methods and Fig. 3C. A blot representative of three independent experiments of immunoprecipitation and TRPC1 immunoblot is shown (relative percentage is reported as mean ± s.e.m.). (B) Confocal immunofluorescence analysis of TRPC1 lipid microdomain localization (triple labelling). C2C12 myoblasts treated with (a,b) DHCB to inhibit actin polymerization or (d,e) S1P to induce stress fibre formation, were incubated with Alexa Fluor 488-conjugated CT-B (green), processed for TRPC1 immunostaining (red) and (b,e) counterstained with Alexa Fluor 647-labelled phalloidin to reveal actin filaments. Yellow spots in panels a and d indicate co-localization of red and green fluorescence signals. (c,f) Scatter plots indicate the distribution of TRPC1 and lipid-raft fluorescence intensity signals. The images are representative of at least three independent experiments with similar results.

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 4. Effects of stress fibre formation and cytoskeletal integrity on TRPC1-cortactin interaction, channel expression and localization. (A) Co-immunoprecipitation of TRPC1 with cortactin. C2C12 cells were incubated in the presence or absence (–) of 1 μM S1P or of 1 μg/ml DHCB, for 30 minutes and collected in lysis buffer and immunoprecipitation performed as reported in the Materials and Methods and Fig. 3C. A blot representative of three independent experiments of immunoprecipitation and TRPC1 immunoblot is shown (relative percentage is reported as mean ± s.e.m.). (B) Confocal immunofluorescence analysis of TRPC1 lipid microdomain localization (triple labelling). C2C12 myoblasts treated with (a,b) DHCB to inhibit actin polymerization or (d,e) S1P to induce stress fibre formation, were incubated with Alexa Fluor 488-conjugated CT-B (green), processed for TRPC1 immunostaining (red) and (b,e) counterstained with Alexa Fluor 647-labelled phalloidin to reveal actin filaments. Yellow spots in panels a and d indicate co-localization of red and green fluorescence signals. (c,f) Scatter plots indicate the distribution of TRPC1 and lipid-raft fluorescence intensity signals. The images are representative of at least three independent experiments with similar results.

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: Expressing, Immunoprecipitation, Incubation, Lysis, Western Blot, Immunofluorescence, Immunostaining, Fluorescence

Fig. 5. Effect of TRPC1 silencing on skeletal myogenic differentiation of C2C12 myoblasts. (A) Western analysis of TRPC1 silencing on the expression of myogenic markers. Confluent C2C12 myoblasts were transfected with SCR-siRNA (–) or TRPC1-siRNA (+), stimulated with (+) or without (–) 1 μM S1P and differentiation started as described in the Materials and Methods. The content of TRPC1, myogenin and α-sarcomeric actin were analysed by western blotting. A blot representative of at least three independent experiments with similar results and the relative percentage is shown (mean ± s.e.m.). (B) Confocal immunofluorescence and phase-contrast analysis of differentiating myoblasts. SCR-siRNA and TRPC1-siRNA cells were cultured on glass coverslips in DM, fixed and stained with the primary antibody against myogenin (green), and counterstained with TRITC-phalloidin to detect actin filaments (red). Parallel experiments were performed to reveal myotube formation by phase contrast. Note that silenced cells reveal reduced nuclear myogenin staining and polyhedral morphology typical of the undifferentiated cells and are unable to form multinucleate myotubes compared to SCR-siRNA cells. The images are representative of at least three separate experiments with similar results.

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 5. Effect of TRPC1 silencing on skeletal myogenic differentiation of C2C12 myoblasts. (A) Western analysis of TRPC1 silencing on the expression of myogenic markers. Confluent C2C12 myoblasts were transfected with SCR-siRNA (–) or TRPC1-siRNA (+), stimulated with (+) or without (–) 1 μM S1P and differentiation started as described in the Materials and Methods. The content of TRPC1, myogenin and α-sarcomeric actin were analysed by western blotting. A blot representative of at least three independent experiments with similar results and the relative percentage is shown (mean ± s.e.m.). (B) Confocal immunofluorescence and phase-contrast analysis of differentiating myoblasts. SCR-siRNA and TRPC1-siRNA cells were cultured on glass coverslips in DM, fixed and stained with the primary antibody against myogenin (green), and counterstained with TRITC-phalloidin to detect actin filaments (red). Parallel experiments were performed to reveal myotube formation by phase contrast. Note that silenced cells reveal reduced nuclear myogenin staining and polyhedral morphology typical of the undifferentiated cells and are unable to form multinucleate myotubes compared to SCR-siRNA cells. The images are representative of at least three separate experiments with similar results.

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: Western Blot, Expressing, Transfection, Immunofluorescence, Cell Culture, Staining

Fig. 6. TRPC1 expression during C2C12 myoblasts differentiation. C2C12 cells were grown until 95% confluence and then cultured for the indicated times in DM. (A) Western blotting analysis of TRPC1 expression. Cell lysates (30 μg) were prepared as described in the Materials and Methods and processed for western blotting analysis. A blot representative of three independent experiments with analogous results is shown. (B) Confocal immunofluorescence analysis showing TRPC1 expression in differentiating myoblasts. Cells at the indicated time were fixed and immunostained for TRPC1 (green). Counterstaining was performed with TRITC-conjugated phalloidin to reveal actin filament organization (red). The images are representative of at least three separate experiments with similar results.

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 6. TRPC1 expression during C2C12 myoblasts differentiation. C2C12 cells were grown until 95% confluence and then cultured for the indicated times in DM. (A) Western blotting analysis of TRPC1 expression. Cell lysates (30 μg) were prepared as described in the Materials and Methods and processed for western blotting analysis. A blot representative of three independent experiments with analogous results is shown. (B) Confocal immunofluorescence analysis showing TRPC1 expression in differentiating myoblasts. Cells at the indicated time were fixed and immunostained for TRPC1 (green). Counterstaining was performed with TRITC-conjugated phalloidin to reveal actin filament organization (red). The images are representative of at least three separate experiments with similar results.

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: Expressing, Cell Culture, Western Blot, Immunofluorescence

Fig. 7. Regulation of TRPC1 expression by known modulators of skeletal myogenesis. (A) Western blotting analysis of TRPC1 expression. C2C12 myoblasts were grown until confluence and cultured in DM in the presence (+) or absence (–) of TGFβ (1 ng/ml). Aliquots of proteins from cell extracts (25 μg) were subjected to western blotting. Proteins were immunodetected using specific anti-TRPC1, myogenin and α-sarcomeric actin antibodies. A blot representative of at least three independent experiments with analogous results and the relative percentage (s.e.m. less than 15%) are shown. (B) Confocal immunofluorescence analysis showing the effect of S1P and TGFβ on myogenin expression. Confluent C2C12 cells were cultured in DM in the presence of either 1 μM S1P or TGFβ, and stained with specific antibodies. Representative merged confocal fluorescence and DIC contrast images of C2C12 cells immunostained for myogenin (green) are shown. (C) Confocal immunofluorescence analysis showing the effect of S1P and TGFβ on TRPC1 expression. Cells processed as in B were stained with anti- TRPC1 antibodies (green). Counterstaining was performed with TRITC- phalloidin to detect actin filaments (red). The images are representative of at least three separate experiments with similar results.

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 7. Regulation of TRPC1 expression by known modulators of skeletal myogenesis. (A) Western blotting analysis of TRPC1 expression. C2C12 myoblasts were grown until confluence and cultured in DM in the presence (+) or absence (–) of TGFβ (1 ng/ml). Aliquots of proteins from cell extracts (25 μg) were subjected to western blotting. Proteins were immunodetected using specific anti-TRPC1, myogenin and α-sarcomeric actin antibodies. A blot representative of at least three independent experiments with analogous results and the relative percentage (s.e.m. less than 15%) are shown. (B) Confocal immunofluorescence analysis showing the effect of S1P and TGFβ on myogenin expression. Confluent C2C12 cells were cultured in DM in the presence of either 1 μM S1P or TGFβ, and stained with specific antibodies. Representative merged confocal fluorescence and DIC contrast images of C2C12 cells immunostained for myogenin (green) are shown. (C) Confocal immunofluorescence analysis showing the effect of S1P and TGFβ on TRPC1 expression. Cells processed as in B were stained with anti- TRPC1 antibodies (green). Counterstaining was performed with TRITC- phalloidin to detect actin filaments (red). The images are representative of at least three separate experiments with similar results.

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: Expressing, Western Blot, Cell Culture, Immunofluorescence, Staining, Fluorescence

Fig. 8. Effects of TRPC1-siRNA and 2-APB on Gm/Cm in differentiating unstimulated and S1P-stimulated C2C12 myoblasts. C2C12 differentiating cells were transfected with scrambled-siRNA (SCR) and TRPC1-siRNA (siTRPC1) or treated with 2-APB in the presence or in the absence of S1P and incubated in DM for 24 hours. Significance of differences: *P<0.05, **P<0.01 with respect to relative controls; §§P<0.01 of TRPC1-siRNA (siTRPC1) with respect to SCR-siRNA (one-way ANOVA). Data are mean ± s.e.m. of 14-18 independent cell recordings.

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 8. Effects of TRPC1-siRNA and 2-APB on Gm/Cm in differentiating unstimulated and S1P-stimulated C2C12 myoblasts. C2C12 differentiating cells were transfected with scrambled-siRNA (SCR) and TRPC1-siRNA (siTRPC1) or treated with 2-APB in the presence or in the absence of S1P and incubated in DM for 24 hours. Significance of differences: *P<0.05, **P<0.01 with respect to relative controls; §§P<0.01 of TRPC1-siRNA (siTRPC1) with respect to SCR-siRNA (one-way ANOVA). Data are mean ± s.e.m. of 14-18 independent cell recordings.

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: Transfection, Incubation

IRE1 is required in C2C12 differentiation. ( a ) IRE1-knockdown cell lines #1, #2, and mock cells were evaluated for the expression of IRE1/ Ern1 mRNA. Results are means + SEM (three biological replicates). ** p < 0.01. ( b ) Differentiation was induced in IRE1-knockdown cell lines and mock cells. After 48 h, cells were observed under phase contrast. Black arrows show the immature myotubes. Scale bar = 100 µm. ( c , d ) Cells were harvested after differentiation induction at 48 h. mRNA expression of myogenic factors ( c ) and UPR relative factors ( d ) was analyzed by qPCR. Results are means + SEM (three biological replicates). * p < 0.05, ** p < 0.01.

Journal: International Journal of Molecular Sciences

Article Title: IRE1-XBP1 Pathway of the Unfolded Protein Response Is Required during Early Differentiation of C2C12 Myoblasts

doi: 10.3390/ijms21010182

Figure Lengend Snippet: IRE1 is required in C2C12 differentiation. ( a ) IRE1-knockdown cell lines #1, #2, and mock cells were evaluated for the expression of IRE1/ Ern1 mRNA. Results are means + SEM (three biological replicates). ** p < 0.01. ( b ) Differentiation was induced in IRE1-knockdown cell lines and mock cells. After 48 h, cells were observed under phase contrast. Black arrows show the immature myotubes. Scale bar = 100 µm. ( c , d ) Cells were harvested after differentiation induction at 48 h. mRNA expression of myogenic factors ( c ) and UPR relative factors ( d ) was analyzed by qPCR. Results are means + SEM (three biological replicates). * p < 0.05, ** p < 0.01.

Article Snippet: C2C12 mouse myoblasts were obtained from DS Pharma Biomedical (Osaka, Japan).

Techniques: Knockdown, Expressing

IRE1 ribonuclease activity is required in early phase of C2C12 differentiation. ( a ) Differentiation was induced in the presence or absence of IRE1 RNase inhibitor, STF-083010 (60 µM; black bars) or DMSO (gray bars) for various time intervals as indicated. ( b ) Identification of critical time period for inhibitory effect of IRE1 activity on C2C12 differentiation. Scale bar = 200 µm. ( c ) Fusion index of STF-083010- or DMSO-treated cells. Results are mean + SEM (three biological replicates). The different letters denote significant differences between groups at p < 0.05 by Tukey’s HSD test.

Journal: International Journal of Molecular Sciences

Article Title: IRE1-XBP1 Pathway of the Unfolded Protein Response Is Required during Early Differentiation of C2C12 Myoblasts

doi: 10.3390/ijms21010182

Figure Lengend Snippet: IRE1 ribonuclease activity is required in early phase of C2C12 differentiation. ( a ) Differentiation was induced in the presence or absence of IRE1 RNase inhibitor, STF-083010 (60 µM; black bars) or DMSO (gray bars) for various time intervals as indicated. ( b ) Identification of critical time period for inhibitory effect of IRE1 activity on C2C12 differentiation. Scale bar = 200 µm. ( c ) Fusion index of STF-083010- or DMSO-treated cells. Results are mean + SEM (three biological replicates). The different letters denote significant differences between groups at p < 0.05 by Tukey’s HSD test.

Article Snippet: C2C12 mouse myoblasts were obtained from DS Pharma Biomedical (Osaka, Japan).

Techniques: Activity Assay

XBP1 is required for C2C12 differentiation. ( a ) mRNA expression of Xbp1 and spliced Xbp1 were compared between XBP1-knockdown cells (XBP1-KD) and mock cells. Results are means + SEM (three biological replicates). Student’s t -test. ** p < 0.01. ( b ) XBP1-knockdown cells and mock cells were induced to differentiate until day 5. Cells were observed for immunofluorescent staining with anti-MHC antibody. Scale bar = 200 µm. ( c ) Fusion index of mock or XBP1-KD cells. Results are mean + SEM (three biological replicates). Student’s t -test. ** p < 0.01. ( d ) Cells were harvested on the indicated day. mRNA expression of each myogenic factor was analyzed by qPCR. Results are means + SEM (three biological replicates). Student’s t -test. * p < 0.05, ** p < 0.01.

Journal: International Journal of Molecular Sciences

Article Title: IRE1-XBP1 Pathway of the Unfolded Protein Response Is Required during Early Differentiation of C2C12 Myoblasts

doi: 10.3390/ijms21010182

Figure Lengend Snippet: XBP1 is required for C2C12 differentiation. ( a ) mRNA expression of Xbp1 and spliced Xbp1 were compared between XBP1-knockdown cells (XBP1-KD) and mock cells. Results are means + SEM (three biological replicates). Student’s t -test. ** p < 0.01. ( b ) XBP1-knockdown cells and mock cells were induced to differentiate until day 5. Cells were observed for immunofluorescent staining with anti-MHC antibody. Scale bar = 200 µm. ( c ) Fusion index of mock or XBP1-KD cells. Results are mean + SEM (three biological replicates). Student’s t -test. ** p < 0.01. ( d ) Cells were harvested on the indicated day. mRNA expression of each myogenic factor was analyzed by qPCR. Results are means + SEM (three biological replicates). Student’s t -test. * p < 0.05, ** p < 0.01.

Article Snippet: C2C12 mouse myoblasts were obtained from DS Pharma Biomedical (Osaka, Japan).

Techniques: Expressing, Knockdown, Staining

CDK5 is a downstream target of IRE1-XBP1 in C2C12 cells. ( a ) mRNA expression of Xbp1 and Cdk5 during C2C12 differentiation. Results are means + SEM (three biological replicates). Student’s t -test. ** p < 0.01. ( b ) An illustration of the predicted mouse Cdk5 promoter region. The region upstream of the Cdk5 gene comprises three XBP1-binding domains including CCAAT at −544 bp, TGCCACGTGG at −597 bp, and CCACGT at −1112 bp from the transcription start site. ( c , d ) Chromatin immunoprecipitation assay using a C2C12 genomic sample. Input DNA = positive control. Rabbit IgG was used as negative control ChIP ( c ). ChIP assay was performed by quantitative PCR analysis ( d ). Results are means + SEM (three biological replicates). Student’s t -test. * p < 0.05. ( e ) XBP1-knockdown and mock cells were transfected with the vector containing the Cdk5 promoter construct ( p 1400) or an empty vector. Cdk5 promoter activity was assessed by luciferase assay. Results are means + SEM (three biological replicates). Student’s t -test. ** p < 0.01.

Journal: International Journal of Molecular Sciences

Article Title: IRE1-XBP1 Pathway of the Unfolded Protein Response Is Required during Early Differentiation of C2C12 Myoblasts

doi: 10.3390/ijms21010182

Figure Lengend Snippet: CDK5 is a downstream target of IRE1-XBP1 in C2C12 cells. ( a ) mRNA expression of Xbp1 and Cdk5 during C2C12 differentiation. Results are means + SEM (three biological replicates). Student’s t -test. ** p < 0.01. ( b ) An illustration of the predicted mouse Cdk5 promoter region. The region upstream of the Cdk5 gene comprises three XBP1-binding domains including CCAAT at −544 bp, TGCCACGTGG at −597 bp, and CCACGT at −1112 bp from the transcription start site. ( c , d ) Chromatin immunoprecipitation assay using a C2C12 genomic sample. Input DNA = positive control. Rabbit IgG was used as negative control ChIP ( c ). ChIP assay was performed by quantitative PCR analysis ( d ). Results are means + SEM (three biological replicates). Student’s t -test. * p < 0.05. ( e ) XBP1-knockdown and mock cells were transfected with the vector containing the Cdk5 promoter construct ( p 1400) or an empty vector. Cdk5 promoter activity was assessed by luciferase assay. Results are means + SEM (three biological replicates). Student’s t -test. ** p < 0.01.

Article Snippet: C2C12 mouse myoblasts were obtained from DS Pharma Biomedical (Osaka, Japan).

Techniques: Expressing, Binding Assay, Chromatin Immunoprecipitation, Positive Control, Negative Control, Real-time Polymerase Chain Reaction, Knockdown, Transfection, Plasmid Preparation, Construct, Activity Assay, Luciferase

Myosin heavy chain (MyHC) expression in parental C2C12 cells and C2C12-derived cells permanently expressing Wnt4. Parental C2C12 cells (a, b, e, and f) and W4-08 cells (c, d, g, and h) were cultured for 2 days in proliferation medium containing 10% fetal bovine serum (a–d), or in differentiation medium containing 2% horse serum (e–h), and then immunohistochemically stained with anti-MyHC antibodies, followed by counterstaining with DAPI. Spontaneous expression of slow-type MyHC was evident in W4-08 cells in proliferation medium and intensified in differentiation medium, although the proliferation rates were greatly reduced compared to those of the parental C2C12 cells, as observed in the reduced number of nuclei (blue).

Journal: International Journal of Cell Biology

Article Title: Interaction of Wnt Signaling with BMP/Smad Signaling during the Transition from Cell Proliferation to Myogenic Differentiation in Mouse Myoblast-Derived Cells

doi: 10.1155/2013/616294

Figure Lengend Snippet: Myosin heavy chain (MyHC) expression in parental C2C12 cells and C2C12-derived cells permanently expressing Wnt4. Parental C2C12 cells (a, b, e, and f) and W4-08 cells (c, d, g, and h) were cultured for 2 days in proliferation medium containing 10% fetal bovine serum (a–d), or in differentiation medium containing 2% horse serum (e–h), and then immunohistochemically stained with anti-MyHC antibodies, followed by counterstaining with DAPI. Spontaneous expression of slow-type MyHC was evident in W4-08 cells in proliferation medium and intensified in differentiation medium, although the proliferation rates were greatly reduced compared to those of the parental C2C12 cells, as observed in the reduced number of nuclei (blue).

Article Snippet: The C2C12 cell line (myoblast-like cell line from the C3H mouse) was purchased from the RIKEN Cell Bank (RIKEN, Wako, Japan) and cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Nichirei Corp., Tokyo).

Techniques: Expressing, Derivative Assay, Cell Culture, Staining

Summary of expression array analysis for C2C12 differentiation and Wnt4 expression. Red and green colors show upregulated and downregulated expression, respectively, with differentiation medium and Wnt4 overexpression. 1477 and 1836 genes were upregulated and downregulated, respectively, in differentiation medium and Wnt4 overexpression at a twofold magnitude. Refer to original data in supplementary 1 for details.

Journal: International Journal of Cell Biology

Article Title: Interaction of Wnt Signaling with BMP/Smad Signaling during the Transition from Cell Proliferation to Myogenic Differentiation in Mouse Myoblast-Derived Cells

doi: 10.1155/2013/616294

Figure Lengend Snippet: Summary of expression array analysis for C2C12 differentiation and Wnt4 expression. Red and green colors show upregulated and downregulated expression, respectively, with differentiation medium and Wnt4 overexpression. 1477 and 1836 genes were upregulated and downregulated, respectively, in differentiation medium and Wnt4 overexpression at a twofold magnitude. Refer to original data in supplementary 1 for details.

Article Snippet: The C2C12 cell line (myoblast-like cell line from the C3H mouse) was purchased from the RIKEN Cell Bank (RIKEN, Wako, Japan) and cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Nichirei Corp., Tokyo).

Techniques: Expressing, Over Expression

Effect of BMP4 and noggin on the myogenic differentiation of C2C12 cells. (a–d) The recombinant proteins were added to the proliferation medium at final concentrations of 5 ng/mL BMP4 and/or 50 ng/mL noggin and cultured in proliferation medium for 3 days, followed by immunostaining with anti-troponin T antibodies (red) and anti-phosphohistone H3 (Ser10) antibodies (green). BMP4 addition inhibited myogenic differentiation in proliferation medium. The number of cells expressing phosphorylated histone H3 was increased by adding noggin but not BMP4. (a) Control; (b) noggin; (c) BMP4; (d) noggin + BMP4. (e–g) The ratios of phosphohistone H3 (e) and troponin T-positive cells (f) to the total cell number were estimated. The number of multinuclear cells expressing troponin T (g) was also estimated to determine the ratio of fused cells among the total cells. Mean + SD ( n = 3), * P < 0.05 versus control with Student's t -test.

Journal: International Journal of Cell Biology

Article Title: Interaction of Wnt Signaling with BMP/Smad Signaling during the Transition from Cell Proliferation to Myogenic Differentiation in Mouse Myoblast-Derived Cells

doi: 10.1155/2013/616294

Figure Lengend Snippet: Effect of BMP4 and noggin on the myogenic differentiation of C2C12 cells. (a–d) The recombinant proteins were added to the proliferation medium at final concentrations of 5 ng/mL BMP4 and/or 50 ng/mL noggin and cultured in proliferation medium for 3 days, followed by immunostaining with anti-troponin T antibodies (red) and anti-phosphohistone H3 (Ser10) antibodies (green). BMP4 addition inhibited myogenic differentiation in proliferation medium. The number of cells expressing phosphorylated histone H3 was increased by adding noggin but not BMP4. (a) Control; (b) noggin; (c) BMP4; (d) noggin + BMP4. (e–g) The ratios of phosphohistone H3 (e) and troponin T-positive cells (f) to the total cell number were estimated. The number of multinuclear cells expressing troponin T (g) was also estimated to determine the ratio of fused cells among the total cells. Mean + SD ( n = 3), * P < 0.05 versus control with Student's t -test.

Article Snippet: The C2C12 cell line (myoblast-like cell line from the C3H mouse) was purchased from the RIKEN Cell Bank (RIKEN, Wako, Japan) and cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Nichirei Corp., Tokyo).

Techniques: Recombinant, Cell Culture, Immunostaining, Expressing

Effects of BMP4 and noggin on phospho-Smad1/5 expression with or without Wnt3a and Wnt4. (a–l) Recombinant adenoviruses were used to express Wnt3a , Wnt4 , or eGFP (control) uniformly in C2C12 cells. Cells were infected 48 hours earlier with an MOI of 400, and the recombinant proteins were added as shown in with final concentrations of 5 ng/mL BMP4 and/or 250 ng/mL noggin. Two hours after BMP4 addition, immunostaining for phospho-Smad1/5 was carried out for counting. (a–c) Control; (d–f) BMP4; (g–i) noggin; (j–l) BMP4 + noggin. (m) The ratio of the nuclear phospho-Smad1/5-positive cells to the total cell number was estimated in three independent experiments counted for 6 fields each (mean + SD, n = 18, * P < 0.05 with Student's t -test).

Journal: International Journal of Cell Biology

Article Title: Interaction of Wnt Signaling with BMP/Smad Signaling during the Transition from Cell Proliferation to Myogenic Differentiation in Mouse Myoblast-Derived Cells

doi: 10.1155/2013/616294

Figure Lengend Snippet: Effects of BMP4 and noggin on phospho-Smad1/5 expression with or without Wnt3a and Wnt4. (a–l) Recombinant adenoviruses were used to express Wnt3a , Wnt4 , or eGFP (control) uniformly in C2C12 cells. Cells were infected 48 hours earlier with an MOI of 400, and the recombinant proteins were added as shown in with final concentrations of 5 ng/mL BMP4 and/or 250 ng/mL noggin. Two hours after BMP4 addition, immunostaining for phospho-Smad1/5 was carried out for counting. (a–c) Control; (d–f) BMP4; (g–i) noggin; (j–l) BMP4 + noggin. (m) The ratio of the nuclear phospho-Smad1/5-positive cells to the total cell number was estimated in three independent experiments counted for 6 fields each (mean + SD, n = 18, * P < 0.05 with Student's t -test).

Article Snippet: The C2C12 cell line (myoblast-like cell line from the C3H mouse) was purchased from the RIKEN Cell Bank (RIKEN, Wako, Japan) and cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Nichirei Corp., Tokyo).

Techniques: Expressing, Recombinant, Infection, Immunostaining

Effects of BMP4 and noggin on β-catenin localization with or without Wnt3a and Wnt4. (a–i) Recombinant adenoviruses were used to express Wnt3a , Wnt4 , or eGFP (control) uniformly in C2C12 cells. Cells were infected 48 hours earlier with an MOI of 400, and the recombinant proteins were added as shown in with final concentrations of 5 ng/mL BMP4 and/or 250 ng/mL noggin. Two hours after BMP4 addition, immunostaining for β-catenin was carried out for counting. (j) Comparison of the β-catenin signals after adenovirus-mediated expression of Wnt3a and eGFP , after pixel intensity analysis for immunohistochemical signals with BZ-II Analyzer, shown in abscissa for signal intensity and ordinate for frequency. Wnt3a intensified signals to a higher level. (k and l) Comparison of the β-catenin signals after adenovirus-mediated expression of Wnt3a , Wnt4, and eGFP , in the presence or absence of BMP4 and/or noggin. Immunostaining for β-catenin was analyzed by digitizing the signals with BZ-II Analyzer for comparison. Typical results are shown. (k) Without BMP4; (l) with BMP4.

Journal: International Journal of Cell Biology

Article Title: Interaction of Wnt Signaling with BMP/Smad Signaling during the Transition from Cell Proliferation to Myogenic Differentiation in Mouse Myoblast-Derived Cells

doi: 10.1155/2013/616294

Figure Lengend Snippet: Effects of BMP4 and noggin on β-catenin localization with or without Wnt3a and Wnt4. (a–i) Recombinant adenoviruses were used to express Wnt3a , Wnt4 , or eGFP (control) uniformly in C2C12 cells. Cells were infected 48 hours earlier with an MOI of 400, and the recombinant proteins were added as shown in with final concentrations of 5 ng/mL BMP4 and/or 250 ng/mL noggin. Two hours after BMP4 addition, immunostaining for β-catenin was carried out for counting. (j) Comparison of the β-catenin signals after adenovirus-mediated expression of Wnt3a and eGFP , after pixel intensity analysis for immunohistochemical signals with BZ-II Analyzer, shown in abscissa for signal intensity and ordinate for frequency. Wnt3a intensified signals to a higher level. (k and l) Comparison of the β-catenin signals after adenovirus-mediated expression of Wnt3a , Wnt4, and eGFP , in the presence or absence of BMP4 and/or noggin. Immunostaining for β-catenin was analyzed by digitizing the signals with BZ-II Analyzer for comparison. Typical results are shown. (k) Without BMP4; (l) with BMP4.

Article Snippet: The C2C12 cell line (myoblast-like cell line from the C3H mouse) was purchased from the RIKEN Cell Bank (RIKEN, Wako, Japan) and cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Nichirei Corp., Tokyo).

Techniques: Recombinant, Infection, Immunostaining, Expressing, Immunohistochemical staining

(A) ERMS cells were infected with CHIKV at 1 MOI. At 0 h pi, the cell culture medium was supplemented with WFA (1 μM) or the vehicle DMSO (control). The total RNA was isolated at different times pi to quantify the intracellular viral RNA levels by qRT-PCR. The relative levels of the CHIKV RNA are shown in the left panel, where the CHIKV RNA level at 6 h pi in the control was taken as 1. The culture supernatant from the CHIKV-infected cells was collected, and the virus titers determined by the plaque assay are shown in the right panel. (B) ERMS cells infected with CHIKV (1 MOI) were treated with different concentrations of WFA. The cells were processed at 6 h pi for the intracellular viral RNA quantitation by qRT-PCR and cell viability by the MTT assay. The line graph demonstrating the relative viral RNA levels and per cent cell viability at the indicated WFA concentrations is shown. The viral RNA levels and per cent cell viability were normalized to the respective vehicle-only controls. (C) HeLa, Huh7, or C2C12 cells were infected with CHIKV (MOI 1) in the presence of WFA or DMSO (vehicle control), and the total RNA was isolated at 6 h pi. The relative CHIKV RNA levels determined by qRT-PCR are presented where the level of CHIKV RNA in the control cells was taken as 1. The student’s t-test was used to calculate the p values; * p <0.05, ** p <0.01, *** p <0.001.

Journal: PLOS Pathogens

Article Title: Withaferin A inhibits Chikungunya virus nsP2 protease and shows antiviral activity in the cell culture and mouse model of virus infection

doi: 10.1371/journal.ppat.1012816

Figure Lengend Snippet: (A) ERMS cells were infected with CHIKV at 1 MOI. At 0 h pi, the cell culture medium was supplemented with WFA (1 μM) or the vehicle DMSO (control). The total RNA was isolated at different times pi to quantify the intracellular viral RNA levels by qRT-PCR. The relative levels of the CHIKV RNA are shown in the left panel, where the CHIKV RNA level at 6 h pi in the control was taken as 1. The culture supernatant from the CHIKV-infected cells was collected, and the virus titers determined by the plaque assay are shown in the right panel. (B) ERMS cells infected with CHIKV (1 MOI) were treated with different concentrations of WFA. The cells were processed at 6 h pi for the intracellular viral RNA quantitation by qRT-PCR and cell viability by the MTT assay. The line graph demonstrating the relative viral RNA levels and per cent cell viability at the indicated WFA concentrations is shown. The viral RNA levels and per cent cell viability were normalized to the respective vehicle-only controls. (C) HeLa, Huh7, or C2C12 cells were infected with CHIKV (MOI 1) in the presence of WFA or DMSO (vehicle control), and the total RNA was isolated at 6 h pi. The relative CHIKV RNA levels determined by qRT-PCR are presented where the level of CHIKV RNA in the control cells was taken as 1. The student’s t-test was used to calculate the p values; * p <0.05, ** p <0.01, *** p <0.001.

Article Snippet: The human embryonal rhabdomyosarcoma (ERMS) (RD-CCL-136-ATCC) and mouse myoblast C2C12 cells (C2C12-CRL-1722-ATCC) were obtained from the ATCC, USA.

Techniques: Infection, Cell Culture, Control, Isolation, Quantitative RT-PCR, Virus, Plaque Assay, Quantitation Assay, MTT Assay